View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_54 (Length: 258)
Name: NF9782A_low_54
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_54 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 122 - 258
Target Start/End: Original strand, 33576061 - 33576197
Alignment:
| Q |
122 |
gatcgggtcagacccgacccaatgtgttcagaccgagacgaattgtaagacatggttgtgtgttgtacacccatgttaacttgtatgcatgtttatttga |
221 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33576061 |
gatcgggtcagatccgacccaatgtgttcagaccgggacgaattgtaggacatggttgtgtgttgtacacccatgttaacttgtatgcatgtttatttga |
33576160 |
T |
 |
| Q |
222 |
gagaaaatgatgtaggagagaaatagagagaaagtca |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33576161 |
gagaaaatgatgtaggagagaaatagagagaaagtca |
33576197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University