View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9782A_low_60 (Length: 249)

Name: NF9782A_low_60
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9782A_low_60
NF9782A_low_60
[»] chr7 (2 HSPs)
chr7 (34-197)||(9457146-9457309)
chr7 (193-240)||(9458329-9458376)


Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 34 - 197
Target Start/End: Original strand, 9457146 - 9457309
Alignment:
34 tgtttactttatagatgatcattagattgtaataaaaatcacatatagccattttggaatacggtaataaaaatctcaacactcattttgttaccgatct 133  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
9457146 tgtttactttatagatgatcattagattgtaataaaaatcacatatagccgttttggaatacggtaataaaaatctcaacactcattttgttaccgatct 9457245  T
134 caagtttgtgttttgtgtaggggagagataaaatgtttataaattacaattaatcttgattttc 197  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
9457246 caagtttgtgttttgcgtaggggagagataaaatgtttataaattacaattaatcttgattttc 9457309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 193 - 240
Target Start/End: Original strand, 9458329 - 9458376
Alignment:
193 ttttcgcaattcctctttcagttccttttggattttgtttatattctt 240  Q
    ||||| |||||||||||||| ||||||||||||||||||||| |||||    
9458329 ttttcacaattcctctttcaattccttttggattttgtttatgttctt 9458376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University