View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_65 (Length: 248)
Name: NF9782A_low_65
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_65 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 221
Target Start/End: Complemental strand, 37492342 - 37492128
Alignment:
| Q |
7 |
aatgagatggaatggattggatcagaatggatcggattggacggaacacagcttctgtaatctgtactgctttgctccttatcctttgccatttcaagta |
106 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492342 |
aatgaaatggaatggattggatcggaatggatcggattggacggaacacagcttctgtaatctgaactgctttgctccttatcctttgccatttcaagta |
37492243 |
T |
 |
| Q |
107 |
aaacaaccaaagaaatcaaagcatcattacaaaaataagagtagcatcattctaatttgaaattaaatgtaaacagaatgatcttaaccactatgcagta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37492242 |
aaacaaccaaagaaatcaaagcatcattacaaaaataagagtagcatcattctgatttgaaattaaatgtaaacagaatgattttaaccactatgcagta |
37492143 |
T |
 |
| Q |
207 |
tgcacatacaccatg |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37492142 |
tgcacatacaccatg |
37492128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University