View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_69 (Length: 245)
Name: NF9782A_low_69
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 23 - 224
Target Start/End: Original strand, 56176298 - 56176499
Alignment:
| Q |
23 |
ctttcttctatacatttttcttcaatactgcaacttgtataaaaacatactctgttcactatttctctttaccgttgtatttcataatacttgtgtgttc |
122 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56176298 |
ctttcttctatacatttttcttcaacactgcaacttgtataaaaacatactctgttcactatttctctttaccgttgtatttcataatacttgtgtgttc |
56176397 |
T |
 |
| Q |
123 |
gttttggttgatccattgattttatgttagaagaaccgtattgtcaattcacaattgcattgcttttagtagatttatatcttgaatactttgttacaag |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56176398 |
gttttggttgatccattgattttatgttataagaaccgtattgtcaattcacaattgcattgcttttagtagatttatatcttgaatactttgttacaag |
56176497 |
T |
 |
| Q |
223 |
aa |
224 |
Q |
| |
|
|| |
|
|
| T |
56176498 |
aa |
56176499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University