View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_79 (Length: 241)
Name: NF9782A_low_79
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_79 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 26 - 241
Target Start/End: Complemental strand, 1045813 - 1045613
Alignment:
| Q |
26 |
ataagttatagccacaattcaagtcatatcaactccttaaacaaactacttttccattttctttaaattttaacaaaaatttcagtcacacacacagaat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1045813 |
ataagttatagccacaattcaagtcatatcaactccttaaacaaactacttttccattttctttaaattttaacaaaaatttcagtcaca--cacagaat |
1045716 |
T |
|
| Q |
126 |
gtttgccaaaaataacaaataacaagataaattgaaaaaattaggagcacaaaacgtgattacaatgagttatttattatacttgttaatcgaatagatt |
225 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1045715 |
gtttgccaaaaataacagataacaagataaattgaaaaaattaggagc-------------acaatgagttatttattatacttgttaatcgaatagatt |
1045629 |
T |
|
| Q |
226 |
caaacagtgaagaaaa |
241 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1045628 |
caaacagtgaagaaaa |
1045613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University