View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_83 (Length: 239)
Name: NF9782A_low_83
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_83 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 39480371 - 39480137
Alignment:
| Q |
1 |
aagcaatagcaaagaacttgagctggtttacctctctggtggggatagtgagagtcaattttgcctcaaagggtctcttccaaaggacaaagttcaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39480371 |
aagcaatagcaaagaacttgagctggtttacctctctggtggggatagtgagagtcaattttgcctcaaagggtctcttccaaaggacaaagttcaagga |
39480272 |
T |
|
| Q |
101 |
aaaatggtggtatgtgatcgaggtgtcaacggaagatcagaaaagggtcaagctgtgaaggaagcaggcggtgctgctatgatcttggcaaacacagagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39480271 |
aaaatggtggtatgtgatcgaggtgtcaacggaagatcagaaaagggtcaagctgtgaaggaagcaggtggtgctgctatgatcttggcaaacacagagc |
39480172 |
T |
|
| Q |
201 |
taaacttggaagaagattcggttgatgtccatctc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
39480171 |
taaacttggaagaagattcggttgatgttcatctc |
39480137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 39127056 - 39127281
Alignment:
| Q |
1 |
aagcaatagcaaagaacttgagctggtttacctctctggtggggatagtgagagtcaattttgcctcaaagggtctcttccaaaggacaaagttcaagga |
100 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||| |||||| |||||||||||||||||| ||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
39127056 |
aagcaatggcaaagaacttgagccggtttacctaagtggtggagatagtgagagtcaattt-gcctcaatac-tctcttccaaaggtcaaatttcaaggc |
39127153 |
T |
|
| Q |
101 |
aaaatggtggtatgtgatcgaggtgtcaacggaagatcagaaaagggtcaagctgtgaaggaagcaggcggtgctgctatgatcttggcaaacacagagc |
200 |
Q |
| |
|
|||| ||| |||| ||| |||||||||| |||||||||||||||||||||| |||||| |||||| | || ||||||||||||||||||||||||||| |
|
|
| T |
39127154 |
aaaacggtcatatgcgattgaggtgtcaatggaagatcagaaaagggtcaagttgtgaatgaagcaagtagtactgctatgatcttggcaaacacagagc |
39127253 |
T |
|
| Q |
201 |
taaacttggaagaagattcggttgatgt |
228 |
Q |
| |
|
| ||||||||||||||||| ||||||| |
|
|
| T |
39127254 |
ttaacttggaagaagattcaattgatgt |
39127281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University