View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_86 (Length: 237)
Name: NF9782A_low_86
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_86 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 23 - 222
Target Start/End: Original strand, 33104506 - 33104705
Alignment:
| Q |
23 |
ttgtttgcatatgcacagggttgtttatggctctacaacccaagatgattgcatgtggaaactcagttgcttcatttgcaatggctgttcgatttcttac |
122 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33104506 |
ttgtttgcatatgcacaggtttgtttatggctctacaacccaagatgattgcatgtggaaactcagttgcttcatttgcaatggctgttcgatttcttac |
33104605 |
T |
|
| Q |
123 |
aggtcctgcagtcatggctgcagcttccattgctgttggactgcgtggtaaccttttacgtgtagctattgttcaggtatataattaaccttgatgtcca |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33104606 |
aggtcctgcagtcatggctgcagcttccattgctgttggactgcgtggtaaccttttacgtgtagctattgttcaggtatataattaaccttgatttcca |
33104705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 44 - 200
Target Start/End: Complemental strand, 10835962 - 10835806
Alignment:
| Q |
44 |
tgtttatggctctacaacccaagatgattgcatgtggaaactcagttgcttcatttgcaatggctgttcgatttcttacaggtcctgcagtcatggctgc |
143 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| || || |||||||||||||| |||||| | |||| ||||| ||||| ||||| ||||| || |
|
|
| T |
10835962 |
tgtttatggctcttcaacccaagatcattgcatgtgggaattctgttgcttcatttgccatggctataagattccttactggtccagcagttatggcagc |
10835863 |
T |
|
| Q |
144 |
agcttccattgctgttggactgcgtggtaaccttttacgtgtagctattgttcaggt |
200 |
Q |
| |
|
|||||| || || ||||| || ||||| | ||| ||| |||||||||||||||||| |
|
|
| T |
10835862 |
agcttctatcgccgttggcctccgtgggaccctcctacatgtagctattgttcaggt |
10835806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University