View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_87 (Length: 236)
Name: NF9782A_low_87
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_87 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 33576390 - 33576173
Alignment:
| Q |
19 |
acatcacatggcaattggcatattgccgttgcaaaaataaattcaaacataagtacattttagtgaaaagttggacatgtgccgtccacttaatttttct |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33576390 |
acattacatggcaattggcatattgccgttgcaaaaataaattcaaacatatgtacattttagtgaaaagttggacatgtgccgtccacttaatttttct |
33576291 |
T |
|
| Q |
119 |
cctaataagtttgtgtatatttaaaataaatcctgaaattctacaaatgaattgtcgggaattatttaggattgagtgtcagtaaacttaccatgacttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33576290 |
cctaataagtttgtgtatatttaaaataaatcctgaaattctacaaatgaattgtcgggaatcatttaggattgagtgtcactaaacttaccatgacttt |
33576191 |
T |
|
| Q |
219 |
ctctctatttctctccta |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33576190 |
ctctctatttctctccta |
33576173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University