View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_88 (Length: 236)
Name: NF9782A_low_88
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_88 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 40 - 227
Target Start/End: Complemental strand, 32350847 - 32350647
Alignment:
| Q |
40 |
tctagttgcatcctacatgtttgataatatctgtcttagataacaacaaaccagtttcatct-------------tgtcttttgtttattttcatggcaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32350847 |
tctagttgcatcctacatgtttgataatatctgtcttagataacaacaaaccagtttcatctactcatttcatcttgtcttttgtttattttcatggcaa |
32350748 |
T |
 |
| Q |
127 |
aatcctttgaatctgtgcgacaagaattatcacgaattgcaaaatctgcaacaaaaatccatagaccaaaacaaacccaacccgtatcattgaaccagtt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32350747 |
aatcctttgaatctgtgcgacaagaattatcacgaattgcaaaatctgcaacaaaaatccatagaccaaaacaaacccaacccgtatcattgaaccagtt |
32350648 |
T |
 |
| Q |
227 |
c |
227 |
Q |
| |
|
| |
|
|
| T |
32350647 |
c |
32350647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University