View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_92 (Length: 230)
Name: NF9782A_low_92
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_92 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 83 - 198
Target Start/End: Original strand, 42018065 - 42018180
Alignment:
| Q |
83 |
actttaacaataattgaatatatagtttcgactaatttcctctctctttataggctgtcaatggtggttgcattgtaattagatgcctcacgagacttta |
182 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42018065 |
actttaacgataattgaatatatagtttcgactaatttcctctctctttataggctgtcaatggtggttgcattgtaattagatgcctcacgagacttta |
42018164 |
T |
 |
| Q |
183 |
gttacatttctttcat |
198 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42018165 |
gttacatttctttcat |
42018180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University