View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_98 (Length: 228)
Name: NF9782A_low_98
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_98 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 11 - 187
Target Start/End: Complemental strand, 7440833 - 7440657
Alignment:
| Q |
11 |
aatatatatagtattactgctatgattcagttaacaatattacctctgatgagccataatacaaccggcccttgccttctttaatgttttgcatatatta |
110 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| ||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
7440833 |
aatatatataatattactactatgattcagttaacaatattacctctgatgagccatactactaccgccccttgccttatttaatgtcttgcatatatta |
7440734 |
T |
 |
| Q |
111 |
ggtatactttaacaacttagaaatcaaaattaaagataatttataacgcttgatttcctcaattcactctagccatt |
187 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7440733 |
ggtaaactttaacaacttagaaatcaaaattaaagataatttataacacttgatttcctcaattcactctagccatt |
7440657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University