View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782A_low_99 (Length: 227)
Name: NF9782A_low_99
Description: NF9782A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782A_low_99 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 20 - 207
Target Start/End: Complemental strand, 5726543 - 5726343
Alignment:
| Q |
20 |
atgaagcataaaatttagagttaattgttgcacccttaacttcttagtttttccttagcaaacaaataatgtctcgt--------------agagattcc |
105 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |||||||||| | | ||||||||| |
|
|
| T |
5726543 |
atgaagcataaaatttagagttaatttttgcaaccttaacttcttagtttttccttagcaa-caaataatgtaacatctacgagcaattgcagagattcc |
5726445 |
T |
|
| Q |
106 |
ttttgagttaattgatatcattttatgatattgacatattcgggtatatatttctcatatgcacaggtttaaattggaactccaaactaaataattagtt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5726444 |
ttttgagttaattgatatcattttatgatattgacatattcgggtatatatttttcatatgcacaggtttaaattgaaactccaaactaaataattagtt |
5726345 |
T |
|
| Q |
206 |
ta |
207 |
Q |
| |
|
|| |
|
|
| T |
5726344 |
ta |
5726343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University