View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9782_high_11 (Length: 242)

Name: NF9782_high_11
Description: NF9782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9782_high_11
NF9782_high_11
[»] chr5 (5 HSPs)
chr5 (1-224)||(9894391-9894614)
chr5 (1-140)||(9869841-9869985)
chr5 (62-224)||(9866882-9867047)
chr5 (45-218)||(12531237-12531413)
chr5 (45-218)||(12547206-12547382)
[»] scaffold0197 (1 HSPs)
scaffold0197 (45-216)||(30759-30933)
[»] chr7 (1 HSPs)
chr7 (45-216)||(21317321-21317495)
[»] chr8 (4 HSPs)
chr8 (59-156)||(43479895-43479992)
chr8 (101-221)||(38799237-38799360)
chr8 (101-221)||(38822157-38822280)
chr8 (45-216)||(26591915-26592089)
[»] chr2 (1 HSPs)
chr2 (45-216)||(13576095-13576269)


Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 9894614 - 9894391
Alignment:
Q  1 atttccctcacaagtctctgaaacggaagcttccttattagaattgctcctctggtaattgcggatctcacgaagagcaaccgttccatgacaaaaatgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  9894614 atttccctcacaagtctctgaaacggaagcttccttattagaagtgctcctctggtaattacggatctcacgaagagcaaccgttccatgacaaaaatgg 9894515  T
Q  101 tgtggcttcttcactgttccggctgccagagctgattttcgagcggctttggtggcaagctgctttcgtggtgctttgccgccagtattgcgtgctgttt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9894514 tgtggcttcttcactgttccggctgccagagctgattttcgagcggctttggtggcaagctgctttcgtggtgctttgccgccagtattgcgtgctgttt 9894415  T
Q  201 gcttggtacctgccatggtgattg 224  Q
    ||||||||||||||||||||||||    
T  9894414 gcttggtacctgccatggtgattg 9894391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 9869985 - 9869841
Alignment:
Q  1 atttccctcacaagtctctgaaacggaagcttccttattagaat-----tgctcctctggtaattgcggatctcacgaagagcaaccgttccatgacaaa 95  Q
    ||||||||||||||||||| |||||||||||||||||||||||      ||||| ||||||| || |||||||||||||||||||| ||||||||||| |    
T  9869985 atttccctcacaagtctctaaaacggaagcttccttattagaagctcagtgctcttctggtacttacggatctcacgaagagcaacggttccatgacaga 9869886  T
Q  96 aatggtgtggcttcttcactgttccggctgccagagctgattttc 140  Q
    ||  |||||| ||||||||||  |||| |||||||||||||||||    
T  9869885 aacagtgtggtttcttcactgccccggttgccagagctgattttc 9869841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 62 - 224
Target Start/End: Original strand, 9866882 - 9867047
Alignment:
Q  62 cggatctcacgaagagcaaccgttccatgacaaaaatggtgtggcttcttcactgttccggctgccagagctgattttcgagcggctttggtggcaagct 161  Q
    |||||||||||||| ||||| |||||| |||  ||| |||||||||||||||||  ||| | |||| |||||||||| ||||| ||||| ||||| ||||    
T  9866882 cggatctcacgaagcgcaacggttccaggacggaaacggtgtggcttcttcactcctcccgttgccggagctgatttccgagcagcttttgtggccagct 9866981  T
Q  162 gctttcgtggtgctttgccgccagt---attgcgtgctgtttgcttggtacctgccatggtgattg 224  Q
     ||||| ||||||||| ||||| ||    ||||| || ||||| ||||||| ||||| ||||||||    
T  9866982 tctttcatggtgctttaccgccggtggatttgcgagccgtttgtttggtacatgccacggtgattg 9867047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 45 - 218
Target Start/End: Complemental strand, 12531413 - 12531237
Alignment:
Q  45 tgctcctctggtaattgcggatctcacgaagagcaaccgttccatgacaaaaatggtgtggcttcttcactgttccggctgccagagctgattttcgagc 144  Q
    ||||| ||||||| ||||||||||||||||| ||||| |||||  |||  ||   |||||||||||| |||  ||||| |||| |||| ||||| || ||    
T  12531413 tgctcttctggtacttgcggatctcacgaagtgcaacagttcctggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggc 12531314  T
Q  145 ggctttggtggcaagctgctttcgtggtgctttgccgccagt---attgcgtgctgtttgcttggtacctgccatgg 218  Q
     ||||| |||||||||||||| | ||||||||| ||||| ||    ||||| ||||||||||||||||  |||||||    
T  12531313 agctttagtggcaagctgcttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccatgg 12531237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 45 - 218
Target Start/End: Original strand, 12547206 - 12547382
Alignment:
Q  45 tgctcctctggtaattgcggatctcacgaagagcaaccgttccatgacaaaaatggtgtggcttcttcactgttccggctgccagagctgattttcgagc 144  Q
    ||||| ||||||| ||||||||||||||||| ||||| |||||  |||  ||   |||||||||||| |||  ||||| |||| |||| ||||| || ||    
T  12547206 tgctcttctggtacttgcggatctcacgaagtgcaacagttcctggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggc 12547305  T
Q  145 ggctttggtggcaagctgctttcgtggtgctttgccgccagt---attgcgtgctgtttgcttggtacctgccatgg 218  Q
     ||||| |||||||||||||| | ||||||||| ||||| ||    ||||| ||||||||||||||||  |||||||    
T  12547306 agctttagtggcaagctgcttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccatgg 12547382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0197 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0197
Description:

Target: scaffold0197; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 45 - 216
Target Start/End: Complemental strand, 30933 - 30759
Alignment:
Q  45 tgctcctctggtaattgcggatctcacgaagagcaaccgttccatgacaaaaatggtgtggcttcttcactgttccggctgccagagctgattttcgagc 144  Q
    ||||| ||||||| |||||||| |||||||| || || |||||  |||  ||| |||||||||||||||||  |||||  ||| |||||||||| || ||    
T  30933 tgctcttctggtacttgcggatttcacgaagcgccacggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgc 30834  T
Q  145 ggctttggtggcaagctgctttcgtggtgctttgccgccagt---attgcgtgctgtttgcttggtacctgccat 216  Q
    |||||||||||| || || || ||||| ||||| ||||| ||    |||||||||||||| ||||||| ||||||    
T  30833 ggctttggtggcgagttgtttgcgtggggcttttccgccggtggatttgcgtgctgtttgtttggtacgtgccat 30759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 45 - 216
Target Start/End: Complemental strand, 21317495 - 21317321
Alignment:
Q  45 tgctcctctggtaattgcggatctcacgaagagcaaccgttccatgacaaaaatggtgtggcttcttcactgttccggctgccagagctgattttcgagc 144  Q
    ||||| ||||||| |||||||| |||||||| || || |||||  |||  ||| |||||||||||||||||  |||||  ||| |||||||||| || ||    
T  21317495 tgctcttctggtacttgcggatttcacgaagcgccacggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgc 21317396  T
Q  145 ggctttggtggcaagctgctttcgtggtgctttgccgccagt---attgcgtgctgtttgcttggtacctgccat 216  Q
    |||||||||||| || || || ||||| ||||| ||||| ||    |||||||||||||| ||||||| ||||||    
T  21317395 ggctttggtggcgagttgtttgcgtggggcttttccgccggtggatttgcgtgctgtttgtttggtacgtgccat 21317321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 59 - 156
Target Start/End: Original strand, 43479895 - 43479992
Alignment:
Q  59 ttgcggatctcacgaagagcaaccgttccatgacaaaaatggtgtggcttcttcactgttccggctgccagagctgattttcgagcggctttggtggc 156  Q
    ||||||||||||||||||||||| |||||| |||  ||   ||||||||||||||||  |||||  ||| |||||||||| |||||||||||||||||    
T  43479895 ttgcggatctcacgaagagcaacagttccaggacggaatctgtgtggcttcttcactcctccggtggccggagctgatttccgagcggctttggtggc 43479992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 101 - 221
Target Start/End: Complemental strand, 38799360 - 38799237
Alignment:
Q  101 tgtggcttcttcactgttccggctgccagagctgattttcgagcggctttggtggcaagctgctttcgtggtgctttgccgccagt---attgcgtgctg 197  Q
    |||||||||||||||  |||||  ||| |||||||||| |||||||| |||||||| |||||||| || || || |||||||| ||    ||||| ||||    
T  38799360 tgtggcttcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagccttgccgccggtggatttgcgagctg 38799261  T
Q  198 tttgcttggtacctgccatggtga 221  Q
    |||||||||||| |||||| ||||    
T  38799260 tttgcttggtacgtgccatcgtga 38799237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 101 - 221
Target Start/End: Original strand, 38822157 - 38822280
Alignment:
Q  101 tgtggcttcttcactgttccggctgccagagctgattttcgagcggctttggtggcaagctgctttcgtggtgctttgccgccagt---attgcgtgctg 197  Q
    |||||||||||||||  |||||  ||| |||||||||| |||||||| |||||||| |||||||| || || || |||||||| ||    ||||| ||||    
T  38822157 tgtggcttcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagccttgccgccggtggatttgcgagctg 38822256  T
Q  198 tttgcttggtacctgccatggtga 221  Q
    |||||||||||| |||||| ||||    
T  38822257 tttgcttggtacgtgccatcgtga 38822280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 216
Target Start/End: Complemental strand, 26592089 - 26591915
Alignment:
Q  45 tgctcctctggtaattgcggatctcacgaagagcaaccgttccatgacaaaaatggtgtggcttcttcactgttccggctgccagagctgattttcgagc 144  Q
    ||||| ||||||| |||||||||||||| || || || |||||  | |  ||| |||||||||||||||||   ||||  ||| |||| ||||| |||||    
T  26592089 tgctcttctggtacttgcggatctcacggagtgcgacggttcctggcctgaaacggtgtggcttcttcactccgccggtcgccggagcggatttccgagc 26591990  T
Q  145 ggctttggtggcaagctgctttcgtggtgctttgccgccagt---attgcgtgctgtttgcttggtacctgccat 216  Q
    |||||| || || |||||||| | ||||||||||||||| ||    |||||||| |||||||| |||| ||||||    
T  26591989 ggcttttgttgcgagctgcttccttggtgctttgccgccggtggacttgcgtgcagtttgcttagtacgtgccat 26591915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 45 - 216
Target Start/End: Complemental strand, 13576269 - 13576095
Alignment:
Q  45 tgctcctctggtaattgcggatctcacgaagagcaaccgttccatgacaaaaatggtgtggcttcttcactgttccggctgccagagctgattttcgagc 144  Q
    ||||| |||| || |||||||| ||||||||||| || |||||| |||  ||| | |||||||||||||||  |||||  ||| |||| ||||| |||||    
T  13576269 tgctcttctgatacttgcggatttcacgaagagcgacggttccaggacggaaacgatgtggcttcttcactcctccggtggccggagcggatttccgagc 13576170  T
Q  145 ggctttggtggcaagctgctttcgtggtgctttgccgccagt---attgcgtgctgtttgcttggtacctgccat 216  Q
    |||||| ||||| || || || ||||||||||| ||||| ||    ||||| |||||||| ||||||| ||||||    
T  13576169 ggcttttgtggcgagttgtttgcgtggtgcttttccgccggtggatttgcgggctgtttgtttggtacgtgccat 13576095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University