View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782_low_20 (Length: 237)
Name: NF9782_low_20
Description: NF9782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782_low_20 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 15 - 237
Target Start/End: Complemental strand, 36903643 - 36903421
Alignment:
| Q |
15 |
caaatgatctcaacttcaacacacataaccagccaaagaagaaaaataattaaaagcattacatattacaaatgaatatatccaacaccacattgattat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36903643 |
caaatgatctcaacttcaacacacataaccagccaaagaagaaaaataattaaaagcattacatattacaaatgaatatatccaacaccacattgattat |
36903544 |
T |
|
| Q |
115 |
tccaaatagtgatatagaggttcttaaaaaatgtcaacgtcatcaattgcccttggtatcttagtgaaaatagctgttagaagataatggtacagaggaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36903543 |
tccaaatagtgatatagaggttcttaaaaaatgtcaacgtcatcaattgcccttggtatcttagtgaaaatagctgttagaagataatggtacagaggaa |
36903444 |
T |
|
| Q |
215 |
tttgcgcagcaccatagaaaacc |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36903443 |
tttgcgcagcaccatagaaaacc |
36903421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 106
Target Start/End: Complemental strand, 36893775 - 36893735
Alignment:
| Q |
66 |
aaaagcattacatattacaaatgaatatatccaacaccaca |
106 |
Q |
| |
|
|||||| |||||||||||| |||||| |||||||||||||| |
|
|
| T |
36893775 |
aaaagctttacatattacatatgaatctatccaacaccaca |
36893735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University