View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9782_low_22 (Length: 225)

Name: NF9782_low_22
Description: NF9782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9782_low_22
NF9782_low_22
[»] chr5 (1 HSPs)
chr5 (1-201)||(9944289-9944489)


Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 9944489 - 9944289
Alignment:
1 gaagttagaaaccaactgcgctgcgctggttgtttgtttggataaattaacaacggtggttaggaatgattgattggctgacacgtaagctttccttttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9944489 gaagttagaaaccaactgcgctgcgctggttgtttgtttggataaattaacaacggtggttaggaatgattgattggctgacacgtaagctttccttttc 9944390  T
101 attactacgttctcttttgcaagcttgtgagtaagcataatgtaattagtataactaaatttaaagacatgattgtctttaatgtcccttgacatgacat 200  Q
    ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9944389 attactacgttctcttttgcaagcttgtgagtaagaataatgtgattagtataactaaatttaaagacatgattgtctttaatgtcccttgacatgacat 9944290  T
201 a 201  Q
    |    
9944289 a 9944289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University