View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9782_low_23 (Length: 218)
Name: NF9782_low_23
Description: NF9782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9782_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 72 - 200
Target Start/End: Original strand, 6206131 - 6206252
Alignment:
| Q |
72 |
agaaaagcttcagaacaacataacaacatggctgaatagaaaaataaaattagactagttagagagtatcccaattcccaacacataaacgcattcttgc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6206131 |
agaaaagcttcagaacaacataacaacatggctgaataaaaaaataaaattagactagttagagagta-------tcccaacacataaacgcattcttgc |
6206223 |
T |
|
| Q |
172 |
tcgaaccgaatacaacttgtaccattgat |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||| |
|
|
| T |
6206224 |
tcgaactgaatacaacttgtaccattgat |
6206252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 17 - 63
Target Start/End: Original strand, 6206024 - 6206070
Alignment:
| Q |
17 |
agtaaacatttcttgcagctatctagtgctggaggctttctaaagca |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6206024 |
agtaaacatttcttgcagctatctagtgctggaggctttctaaagca |
6206070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University