View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9783_high_18 (Length: 299)
Name: NF9783_high_18
Description: NF9783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9783_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 156 - 281
Target Start/End: Complemental strand, 48888367 - 48888242
Alignment:
| Q |
156 |
ggtgattaagctctcaagaatgttaaaccagtacagaatcgatttcacattgcaatcttatatacaattctggccaaaagaaaaaagacgaaatttttat |
255 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48888367 |
ggtgattaagctctcaacaatgttaaaccagtacagaatcgatttcacattgcaatcttatatacaattctggccaaaagaaaaaagacgaaatttttat |
48888268 |
T |
 |
| Q |
256 |
caatgtcaacataataaaacagtaac |
281 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
48888267 |
caatgtcaacataataaaacagtaac |
48888242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 48888504 - 48888425
Alignment:
| Q |
18 |
acttaatttaaactagaatgtaaatagcagcactgaacatctaaaatagcacaaataaattcataacatgttcctcctta |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48888504 |
acttaatttaaactagaatgtaaatagcagtactgaacatctaaaatagcacaaataaattcataacatgttcctcctta |
48888425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University