View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9783_high_19 (Length: 288)
Name: NF9783_high_19
Description: NF9783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9783_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 177 - 246
Target Start/End: Original strand, 4468554 - 4468623
Alignment:
| Q |
177 |
ttattattcaaattttgtttgttaacaccatattggcttttgcaatttctagaggtattgatgtcaatat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4468554 |
ttattattcaaattttgtttgttaacaccatattggcttttgcaatttctagaggaattgatgtcaatat |
4468623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 16468226 - 16468198
Alignment:
| Q |
1 |
ttgcttatattagtgaccggaggatgtag |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16468226 |
ttgcttatattagtgaccggaggatgtag |
16468198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 639917 - 639949
Alignment:
| Q |
1 |
ttgcttatattagtgaccggaggatgtagacaa |
33 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
639917 |
ttgcttatattagtgaccggagggtgtagacaa |
639949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University