View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9783_high_23 (Length: 257)
Name: NF9783_high_23
Description: NF9783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9783_high_23 |
 |  |
|
| [»] scaffold1723 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 81 - 235
Target Start/End: Original strand, 14408259 - 14408414
Alignment:
| Q |
81 |
tagtaatcatatataggcatcaaatttaattaagatttgcaataagttttgaaaaacctaacccttannnnnnnctctcc-nnnnnnnnnntaaattcaa |
179 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
14408259 |
tagtaatcatatatagtcatcaaatttaattaagatttgcaataagttttgaaaaacctaacccttatctttttctctccaaacaaaaaaataaattcaa |
14408358 |
T |
 |
| Q |
180 |
caaggtattcaaacaatcacaatgcattccatcaacaagaatatatgatcctcctc |
235 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
14408359 |
taaggtattcaaacaattacaatgcattccatcaacaagattatatgattctcctc |
14408414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1723 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1723
Description:
Target: scaffold1723; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 691 - 727
Alignment:
| Q |
26 |
gacttaaaaacatgattataaatactaggcttttact |
62 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
691 |
gacttaaaaacatgattataaatactagggttttact |
727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University