View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9783_high_26 (Length: 253)
Name: NF9783_high_26
Description: NF9783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9783_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 52169725 - 52169479
Alignment:
| Q |
1 |
tttttgtcggtggatttcgtacattggtaaacatataacacacatgtatattaaaatgcccgagggaaaggaattggctggtttgat-caaaaacattac |
99 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52169725 |
tttttatcggtggatttcgtacatttgtaaacatatatcacacatgtatattaaaatgccagagggaaaggaattggctggtttgatgcaaaaacattac |
52169626 |
T |
|
| Q |
100 |
aaatagtacatcattgaatgg-tatgtacaaatagtataaaatggcaacacttaaacaattgtaggaaaacattgaaaatagaaaaagagtttaacttca |
198 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52169625 |
gaatagtacatcattgaatgggtatgtacaaatagtataaaatggcaacacttaaacacttgtaggaaaacattgaaaatagaaaaagagcttaacttca |
52169526 |
T |
|
| Q |
199 |
agtgtactacacattcactgcgacattttagcataaagatctctgct |
245 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52169525 |
agtgtaatacacattcactgcgacattttagcataaagatttctgct |
52169479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University