View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9783_high_30 (Length: 240)
Name: NF9783_high_30
Description: NF9783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9783_high_30 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 2060175 - 2059952
Alignment:
| Q |
17 |
aatttcccttttattgtttatggaatatgataaagtggtgtctattcattatctctacgtaactttattgtaaggaagnnnnnnnnnccctaggcgactt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2060175 |
aatttcccttttattgtttatggaatatgataaagtggtgtctattcattatctctacgtaactttattgtaaggaagaaaaaaaaaccctaggcgactt |
2060076 |
T |
|
| Q |
117 |
aaattgttccattaacatacgtagtgggaaaacggtgtcaaagtttagactgatattgacaggcatggcatcaactgaatgagatggaaagataattgaa |
216 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2060075 |
aaattgttccattaacattcgtagtgggaaaacggtgtcaaagtttagactgatattgacaggcatggcatcaactgaatgagatggaaagataattgaa |
2059976 |
T |
|
| Q |
217 |
taaacaatcaatgtgaggctggtc |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
2059975 |
taaacaatcaatgtgaggctggtc |
2059952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University