View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9783_high_31 (Length: 239)
Name: NF9783_high_31
Description: NF9783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9783_high_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 44945384 - 44945617
Alignment:
| Q |
1 |
gtttggctataaattattggtgggagattcgttgctttgttggacgggagtttggtggtaacc------aa-------actccctatttcaatccgatca |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
44945384 |
gtttggctataaattattggtgggagattcgttgctttgttggacgggagtttggtggtaaccttaatcaacttagtgactccctatttcaatccgatca |
44945483 |
T |
 |
| Q |
88 |
agatcaaattgttacgccgccttcttctgcaacgaagaaactcaaggaacttatttctttttacggtgttgatctcatctatcttgataacagccttcaa |
187 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44945484 |
agatcaaattgttacgctgccttcttctgcaacgacgaaactcaaggaacttatttctttttacggttttgatctcatctatcttgataacagccttcaa |
44945583 |
T |
 |
| Q |
188 |
gaggtttctgaacaactagttcttatgtaccatg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44945584 |
gaggtttctgaacaactagttcttatgtaccatg |
44945617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University