View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9783_high_8 (Length: 436)
Name: NF9783_high_8
Description: NF9783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9783_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 5e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 12844593 - 12844663
Alignment:
| Q |
1 |
tatcttgatagattttattgatgcttttattttgagttggacttatgctttgaagaaagggaaaagaagaa |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12844593 |
tatcttgatagattttattgatgcttttattttgagttggacttatgctttgaagaaagggaaaagaagaa |
12844663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 142 - 199
Target Start/End: Original strand, 12844734 - 12844794
Alignment:
| Q |
142 |
cattttgtgagttggatcatgtact---gttctatgttttgaagaatgagagatgaagcaa |
199 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12844734 |
cattttgtgagttggatcatgtactactgttctatgttttgaagaatgagagatgaagcaa |
12844794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University