View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9783_low_13 (Length: 436)

Name: NF9783_low_13
Description: NF9783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9783_low_13
NF9783_low_13
[»] chr1 (2 HSPs)
chr1 (1-71)||(12844593-12844663)
chr1 (142-199)||(12844734-12844794)


Alignment Details
Target: chr1 (Bit Score: 71; Significance: 5e-32; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 12844593 - 12844663
Alignment:
1 tatcttgatagattttattgatgcttttattttgagttggacttatgctttgaagaaagggaaaagaagaa 71  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12844593 tatcttgatagattttattgatgcttttattttgagttggacttatgctttgaagaaagggaaaagaagaa 12844663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 142 - 199
Target Start/End: Original strand, 12844734 - 12844794
Alignment:
142 cattttgtgagttggatcatgtact---gttctatgttttgaagaatgagagatgaagcaa 199  Q
    |||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||    
12844734 cattttgtgagttggatcatgtactactgttctatgttttgaagaatgagagatgaagcaa 12844794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University