View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9783_low_26 (Length: 288)

Name: NF9783_low_26
Description: NF9783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9783_low_26
NF9783_low_26
[»] chr4 (2 HSPs)
chr4 (177-246)||(4468554-4468623)
chr4 (1-29)||(16468198-16468226)
[»] chr1 (1 HSPs)
chr1 (1-33)||(639917-639949)


Alignment Details
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 177 - 246
Target Start/End: Original strand, 4468554 - 4468623
Alignment:
177 ttattattcaaattttgtttgttaacaccatattggcttttgcaatttctagaggtattgatgtcaatat 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
4468554 ttattattcaaattttgtttgttaacaccatattggcttttgcaatttctagaggaattgatgtcaatat 4468623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 16468226 - 16468198
Alignment:
1 ttgcttatattagtgaccggaggatgtag 29  Q
    |||||||||||||||||||||||||||||    
16468226 ttgcttatattagtgaccggaggatgtag 16468198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 639917 - 639949
Alignment:
1 ttgcttatattagtgaccggaggatgtagacaa 33  Q
    ||||||||||||||||||||||| |||||||||    
639917 ttgcttatattagtgaccggagggtgtagacaa 639949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University