View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9783_low_38 (Length: 246)
Name: NF9783_low_38
Description: NF9783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9783_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 14396443 - 14396664
Alignment:
| Q |
1 |
cagcagcagcacatgcaagcaaacatctatggaagatatcagaagttagtatttcatgtagtgtttcgggctccttcttcttggctcggcacacacattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14396443 |
cagcagcagcacatgcaagcaaacatctatggaagatatcagaagttagtatttcatgtattgtttcgggctccttcttctcggctcggcacacacattc |
14396542 |
T |
 |
| Q |
101 |
caatactgtatggtataatataaagtaagtgtactaaatcttcgaatctttctatccggccaattatcaggaaatatagtctgcactatactatgtgctc |
200 |
Q |
| |
|
||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14396543 |
caatact-----gtatagtataaagtaagtgtattaaatcttcgaatctttctatccggccaattatcaggaaatatagtctgc-----actatgtgctc |
14396632 |
T |
 |
| Q |
201 |
tgaaactcaaaacatctgtaacatcctcgccc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14396633 |
tgaaactcaaaacatctgtaacatcctcgccc |
14396664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University