View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9783_low_41 (Length: 239)
Name: NF9783_low_41
Description: NF9783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9783_low_41 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 24821167 - 24820947
Alignment:
| Q |
18 |
tataccagctttgtttcctggtgaaattagaattgactaagtaacatggattttgaatcttaagtgttcgtatggtttcagaaaacattttctgttttta |
117 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24821167 |
tataccagctttatttcctggtgaaatcagaattgactaagtaacatggattttgaatcttaagtgttcgtatggtttcagaaaacattttctgttttta |
24821068 |
T |
|
| Q |
118 |
tgttcagttttgggtacaaagatgttacatgtttcactctgtatcctgttctcagttttctaagggcctagttgttaagggtccgttttgattagagggg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24821067 |
tgttcagttttgggtacaaagatgttacatgtttcactctgtatcctgttctcagttttctaagggcctagttgttaagggtccg-tttgattagagggg |
24820969 |
T |
|
| Q |
218 |
aggggagggaaggagaagactt |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
24820968 |
aggggagggaaggagaagactt |
24820947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 24821619 - 24821557
Alignment:
| Q |
19 |
ataccagctttgtttcctggtgaaattagaattgactaagtaacatggattttgaatcttaag |
81 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| ||||||||||||||||| | |||||||| |
|
|
| T |
24821619 |
ataccagctatgttttctggtgaaattagaattggctaagtaacatggatttggcatcttaag |
24821557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University