View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9783_low_44 (Length: 237)

Name: NF9783_low_44
Description: NF9783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9783_low_44
NF9783_low_44
[»] chr7 (1 HSPs)
chr7 (1-223)||(6488700-6488922)


Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 6488922 - 6488700
Alignment:
1 caaggttacttaatggattattggtctgcatgagatcagacctcaacaaccatgtaccgaggtcaaccattggctcgaccgcggtagcatggaggacagc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6488922 caaggttacttaatggattattggtctgcatgagatcagacctcaacaaccatgtaccgaggtcaaccattggctcgaccgcggtagcatggaggacagc 6488823  T
101 agttgatttgagaagttttttggttgggacgtgcgaaaagagtttttcgacgtcgtggaagtcgagattggcgtcgggagggaggatggttgttaccgat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6488822 agttgatttgagaagttttttggttgggacgtgcgaaaagagtttttcgacgtcgtggaagtcgagattggcgtcgggagggaggatggttgttaccgat 6488723  T
201 gatggcagtttttggtctaaaat 223  Q
    |||||||||||||||||||||||    
6488722 gatggcagtttttggtctaaaat 6488700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University