View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9783_low_45 (Length: 235)
Name: NF9783_low_45
Description: NF9783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9783_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 23 - 146
Target Start/End: Original strand, 31263745 - 31263868
Alignment:
| Q |
23 |
gactaaaacattgaaaataattgtacttacttctcatatacaaaattttgtggcattgtgctgagacaaattaagaagtggagaataatcagaaggccca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31263745 |
gactaaaacattgaaaataattgtacttacttctcatatacaaatttttgtggcattgtgttgagacaaattaagaagtggagaataatcagaaggccca |
31263844 |
T |
|
| Q |
123 |
ccaccgtattccataagattgtca |
146 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31263845 |
ccaccgtattccataagattgtca |
31263868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University