View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9783_low_47 (Length: 218)
Name: NF9783_low_47
Description: NF9783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9783_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 27960089 - 27960270
Alignment:
| Q |
15 |
tagatgaatcattataccaaagaatgtacgtggaaaatacgtctcaagctcacactgagtaacatttctccttgcaaacctagaaatttctcaaggtcaa |
114 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27960089 |
tagatgaatcattatactgaagaatgtacgtggaaaatacatctcaagctcacactaagtaacacttctctttgcaaacctagaaatttctcaaggtcaa |
27960188 |
T |
|
| Q |
115 |
tcaccttactataaatcactttgaacaagtagcatagtttgattatagtccacgacatgttttccggcgaaatggaatgcag |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
27960189 |
tcaccttactataaatcactttgaacaagtagcatagtttgattatagtccaccacatgttttctgttaaaatggaatgcag |
27960270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University