View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9785_low_6 (Length: 263)
Name: NF9785_low_6
Description: NF9785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9785_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 34996303 - 34996083
Alignment:
| Q |
20 |
ttgatcccaattgttgagtagactatgatacgacactgcatcttttatagcagcaactgtttctgtaatgatgttatagatggtttgaactgattccgga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34996303 |
ttgatcccaattgttgagtagactatgatacgacactgcatcttttatagcagcaactgtttctgtaatgatgttatagatggtttgaactgattccgga |
34996204 |
T |
|
| Q |
120 |
gcgatagatgcaacattgctggcgttatcaatgatatgaaatgagatagttagaagactttcattgttagcagtactattggcatttccttttcctttat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34996203 |
gcgatagatgcaacattgctggcgttatcaatgatatgaaatgacatagttagaagactttcattgttagcagtactattggcatttccttttcctttat |
34996104 |
T |
|
| Q |
220 |
caccatctcttggtaaccctc |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34996103 |
caccatctcttggtaaccctc |
34996083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 34988036 - 34987816
Alignment:
| Q |
20 |
ttgatcccaattgttgagtagactatgatacgacactgcatcttttatagcagcaactgtttctgtaatgatgttatagatggtttgaactgattccgga |
119 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34988036 |
ttgatcccagttgttgagtcgactatgatacgacactgcatcttttatagcagccattgtttctgtaaccatgttatagatggtttgaactgattccgga |
34987937 |
T |
|
| Q |
120 |
gcgatagatgcaacattgctggcgttatcaatgatatgaaatgagatagttagaagactttcattgttagcagtactattggcatttccttttcctttat |
219 |
Q |
| |
|
| ||| |||||| ||||| |||| ||| |||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
34987936 |
gggattgatgcagcattgttggctttaccaatgatatgaaatgagatagttagaagactttcatcgttagcagtactgttggcatttccttttcctttat |
34987837 |
T |
|
| Q |
220 |
caccatctcttggtaaccctc |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34987836 |
caccatctcttggtaaccctc |
34987816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University