View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9786_high_10 (Length: 285)
Name: NF9786_high_10
Description: NF9786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9786_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 9692760 - 9693029
Alignment:
| Q |
1 |
gatagaaaaaacattgttgtatatgtgttcatttatgggaatgaaacaatgtcatggtgctcaaataaggaatatgttatagctttatactcctgtgagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||| |
|
|
| T |
9692760 |
gatagaaaaaacattgttgtatatgtgttcatttatgggaatgaaacaatgtcatggtgctcaaataagaaatgtgttatagctttatactcttgtgagg |
9692859 |
T |
 |
| Q |
101 |
tagagtacattgcatcttcagtggttgcatataatggttaagcatgtcgatgcaagagatgaatttgaataaagataagaagatgagattattggtgagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692860 |
tagagtacattgcatcttcagtggttgcatataatggttaagcatgttgatgcaagagatgaatttgaataaagataagaagatgagattattggtgagc |
9692959 |
T |
 |
| Q |
201 |
aatagatcagctattgagcttacaaagcatccaattgctcatggaaggatcaattatatagaaatatgat |
270 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9692960 |
aatagatcagctattgagcttgcaaagcatccaattgctcatggaaggatcaaatatatagaaatatgat |
9693029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University