View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9786_high_11 (Length: 278)
Name: NF9786_high_11
Description: NF9786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9786_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 41849627 - 41849864
Alignment:
| Q |
18 |
actaatctattaattatatgaattgtttacccgcttttatatatcaaaatatgtatgaattatgcaatatagcaaattgttgcatagagtgataggctag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
41849627 |
actaatctattaattatatgaattgtttacccacttttatatatcaaaatatgtatgaattatgcaatatagaaaattgtt----------------tag |
41849710 |
T |
 |
| Q |
118 |
ttagtgatgagcgagtgttaatattttcaggtgaatttgaagtttgaacctgagtagcagcagtaacgggaaatgaagcagaagtaacagcataagctgc |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41849711 |
ttagtgatgagcgggtgttaatattttcaggtgaatttgaggtttgaacctgagtagcagcagtaacgggaaatgaagcagaagtaacagcataagctgc |
41849810 |
T |
 |
| Q |
218 |
aagaataccacaggcaacacccttgattttgttgagactaagtaacctttgctt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41849811 |
aagaataccacaggcaacacccttgattttgttgagactaagtaaccttggctt |
41849864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University