View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9786_low_22 (Length: 219)
Name: NF9786_low_22
Description: NF9786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9786_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 207
Target Start/End: Complemental strand, 49942068 - 49941878
Alignment:
| Q |
17 |
catgtctaagggtgaaacttttccaaaccttcacggccagcttgatatgacgggattgaacttccagttattagatgctccatcgtgtttcactgtatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49942068 |
catgtctaagggtgaaacttttccaaaccttcacggccagcttgatatgacgggattgaacttccagttattagatgctccatcgtgtttcactgtatgt |
49941969 |
T |
|
| Q |
117 |
tttccatatttcagtattaaaatgctttgtgcaatccccttttgatatgtttcatttgtaattctctagaaaagcaaccgagcctttgctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49941968 |
tttccatatttcagtattaaaatgctttgtgcaatccccttttgatatgtttcatttgtaattctctagaaaagcaaccgagccattgctt |
49941878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 124
Target Start/End: Original strand, 1906171 - 1906279
Alignment:
| Q |
17 |
catgtctaagggtgaaacttttccaaaccttcacggccagcttgatatgacgggattgaacttccagttattagatgctccatcgtgtttcactgtatgt |
116 |
Q |
| |
|
|||||||||||| || ||||||||||| | ||||| ||||||||| |||| || ||| | ||||| |||||||||||||||| |||| |||||||| |
|
|
| T |
1906171 |
catgtctaagggagagacttttccaaatttgcacggacagcttgatgtgacagggttggatttccaactattagatgctccatcaggtttttctgtatgt |
1906270 |
T |
|
| Q |
117 |
-tttccata |
124 |
Q |
| |
|
|||||||| |
|
|
| T |
1906271 |
ctttccata |
1906279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University