View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9786_low_23 (Length: 216)
Name: NF9786_low_23
Description: NF9786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9786_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 27918665 - 27918634
Alignment:
| Q |
1 |
aatgcttcttggatgatagttggtgagcagaa |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27918665 |
aatgcttcttggatgatagttggtgagcagaa |
27918634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 29568454 - 29568485
Alignment:
| Q |
1 |
aatgcttcttggatgatagttggtgagcagaa |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29568454 |
aatgcttcttggatgatagttggtgagcagaa |
29568485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 29569785 - 29569815
Alignment:
| Q |
1 |
aatgcttcttggatgatagttggtgagcaga |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29569785 |
aatgcttcttggatgatagttggtgagcaga |
29569815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University