View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9787_low_10 (Length: 335)
Name: NF9787_low_10
Description: NF9787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9787_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 153 - 321
Target Start/End: Original strand, 25729773 - 25729941
Alignment:
| Q |
153 |
attgcatgccaaaaggaaaatgtaccttttcgcttggtccgctagtaacatgccatgcattgaccatgaggtcacatgccataaactaaccatatatccc |
252 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25729773 |
attgcatgccaaaaggaaaatgcaccttttcgcttggtccgctagtaacatgccatgcattgaccatgaggtcacatgccataaactaaccatatatcct |
25729872 |
T |
 |
| Q |
253 |
tcttcttgatgggttgtcgatgtcaatttcccaataaatatcaagttaaggaaggaaagtgtagttttt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
25729873 |
tcttcttgatgggttgtcgatgtcaatttcccaataaatatcaagttaaggacggaaagagtagttttt |
25729941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 37 - 138
Target Start/End: Original strand, 25729619 - 25729720
Alignment:
| Q |
37 |
gagactatgcaagaaggagaagagaatggtagtcgaaggtgaaatctttagactcgtaccaatgagagaattcatcatcgttccactaggagtagatcca |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
25729619 |
gagactatgcaagaaggagaagagaatggtagtcgaagttgaaatcttaagactcgtaccaatgagagaattcatcattgttgcactaggagtagatcca |
25729718 |
T |
 |
| Q |
137 |
ag |
138 |
Q |
| |
|
|| |
|
|
| T |
25729719 |
ag |
25729720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University