View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9787_low_11 (Length: 280)
Name: NF9787_low_11
Description: NF9787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9787_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 175 - 268
Target Start/End: Complemental strand, 43177034 - 43176941
Alignment:
| Q |
175 |
agatttcaatgattgagattctcaattgaatcggtcttcactgaacaaaaaggacaggtacggagtatatctttgaaatccgtagaatgatctc |
268 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43177034 |
agatatcaatgattgagattctcaattgaatcggtcttcactgaagaaaaaggacaggtacggagtatatctttgaaatccgtagaatgatctc |
43176941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 6 - 106
Target Start/End: Complemental strand, 43178761 - 43178661
Alignment:
| Q |
6 |
aattaatacttgtatttttcaatccaattggttgatctgacggcgttggtttgaaaacttgaagtggagtgtgctcatctcaagatcttcaattctcctc |
105 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43178761 |
aattaatccttgtatttttcaatccacttggttgatccggtggcgttggtttgaaaacttggagtggagtgtgctcatctcaagatcttcaattctcctc |
43178662 |
T |
|
| Q |
106 |
a |
106 |
Q |
| |
|
| |
|
|
| T |
43178661 |
a |
43178661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University