View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9787_low_13 (Length: 256)
Name: NF9787_low_13
Description: NF9787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9787_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 20 - 243
Target Start/End: Original strand, 42870843 - 42871066
Alignment:
| Q |
20 |
gatctgtgtcattgtttaaatttatcgtgtattatattaatctgttgtacagatctgcttccattgctatgattattctatcagtctttgtactaatatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42870843 |
gatctgtgtcattgtttaaatttatcgtgtattatattaatctgttgtacagatctgcttccattgctatgattattctatcagtctttgtactaatatc |
42870942 |
T |
|
| Q |
120 |
aaattctgcgatcggctgacgaatattgcaattggttgaaatttatttttgtttccccaaagataaacaatttgggatagcggctgtaatcagcaatcac |
219 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42870943 |
aaattctgcgatcggctgacgagtattgcaattggttgaaatttatttttgtttccccaaagataaacaatttgggatagcggctgtaatcagcaatcac |
42871042 |
T |
|
| Q |
220 |
ccgaggcatgatattactgtgtct |
243 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
42871043 |
ccgagacatgatattactgtgtct |
42871066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University