View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9787_low_14 (Length: 255)
Name: NF9787_low_14
Description: NF9787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9787_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 246
Target Start/End: Complemental strand, 2343473 - 2343246
Alignment:
| Q |
19 |
ttatatcataaaaaggtaatcgattttattcgtgttttaaattgcagttgcggtcgtgctacaaactttattgtgacaaaatacttacaattagaaacca |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
2343473 |
ttatatcataaaaagttaatcgattttattcgtgttttaaattgcagttgcggtcgtgctacaaactttattgtgacaaaatactcacaattagaaccca |
2343374 |
T |
 |
| Q |
119 |
tgcgactgtaattgtgattgcgatgtcatcacagagtcctttaaaactttattattggactcatggttttaaattgtagtatataaccataattgtggtc |
218 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||| ||||||||||||| |
|
|
| T |
2343373 |
tgcgactgtgattgtggttgcaatgtcatcacagagtcctttaaaactttattattggagtcatggttttaaattgtagtctgtaaacataattgtggtc |
2343274 |
T |
 |
| Q |
219 |
acatcacaacatattttgaggtctctgc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2343273 |
acatcacaacatattttgaggtctctgc |
2343246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University