View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9787_low_17 (Length: 251)
Name: NF9787_low_17
Description: NF9787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9787_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 69 - 211
Target Start/End: Original strand, 29206530 - 29206672
Alignment:
| Q |
69 |
ttagacattgattatcattagaccggctttgccaaatgtagtgcaattctacagatatgaaattttgtttcaaagagtttagcgaccatactccctgtat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
29206530 |
ttagacattgattatcattagaccggctttgccaaatgtagtgcaattctacagatatgaaattttgtttcaaagagtttagcgactatactccctgcat |
29206629 |
T |
 |
| Q |
169 |
aaaagatttccaatgtgcttgcacacatacgcgcgcgcgcaca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
29206630 |
aaaagatttccaatgtgcttgcacacatacacgcgcgcacaca |
29206672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University