View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9787_low_24 (Length: 229)
Name: NF9787_low_24
Description: NF9787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9787_low_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 6 - 229
Target Start/End: Complemental strand, 40184739 - 40184516
Alignment:
| Q |
6 |
aggaggaatgttgagaaatagaaaaaatactctctttttgattgtggtaatcatgactatatccacccaacaagcactagagagtagataccaattaaca |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40184739 |
aggaggaatgttgagaaatagaaaaaatactctctttttgattgtggtaatcatgactacatccacccaacaagcactagagagtagagaccaattaaca |
40184640 |
T |
 |
| Q |
106 |
ttttgccccaagattgaagcattttgttaaagataaataaagagctcttatacattgccttggtcaaatttgctttctttccattcaccatgctttttcc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40184639 |
ttttgccccaagattgaagcattttgttaaagataaataaagagctcttatacattgccttggtcaaatttgctttctttccattcaccatgctttttcc |
40184540 |
T |
 |
| Q |
206 |
cttgtgattatcttcttgtaaaca |
229 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
40184539 |
cttgtgattatgttcttgtaaaca |
40184516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University