View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9788_high_18 (Length: 218)
Name: NF9788_high_18
Description: NF9788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9788_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 14 - 203
Target Start/End: Original strand, 4065701 - 4065890
Alignment:
| Q |
14 |
gcagagaagacgggagttcggtagagaatatcaatagtccttattgatggagttgcgctcttgtgcagtaaggaacacagaagtcttctttcctacctta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
4065701 |
gcagagaagacgggagttcggtagagaatatcaatagtcctgattgatggagttgcgctcttgtgcggtaaggaacacagaagtcttctttcccacctta |
4065800 |
T |
|
| Q |
114 |
ggtggcaaggattatgggtcactagaccgccagtccaaaacactttgtcttagtgagtttattcacatagaacaagatccttgtaaaaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065801 |
ggtggcaaggattatgggtcactagaccgccagtccaaaacactttgtcttagtgagtttattcacatagaacaagatccttgtaaaaat |
4065890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University