View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9788_high_20 (Length: 206)

Name: NF9788_high_20
Description: NF9788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9788_high_20
NF9788_high_20
[»] chr8 (1 HSPs)
chr8 (16-189)||(28586921-28587094)


Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 16 - 189
Target Start/End: Complemental strand, 28587094 - 28586921
Alignment:
16 agatctatacttgggaacatatggtaaacgtttaccttttcttgttaacttttctattttataaaatatgattggatttagtgaaatgatagtatgagtg 115  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28587094 agatctatacttgggaacatatggtaaacgtttacctattcttgttaacttttctattttataaaatatgattggatttagtgaaatgatagtatgagtg 28586995  T
116 tatgacaccattagctttaatctactcatatattttaccaatctccccatatattctgtatccatatatattac 189  Q
    ||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
28586994 tatgacaccattaactttaatctactgatatattttaccaatctccccatatattctgtatccatatatattac 28586921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University