View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9788_low_35 (Length: 231)
Name: NF9788_low_35
Description: NF9788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9788_low_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 24 - 214
Target Start/End: Original strand, 27171573 - 27171763
Alignment:
| Q |
24 |
ttagcacatcttaatatttaggaaactcactgataaatatacattaatgatagaaaccaaaaagttcacnnnnnnnnnnnnnntagaaaccagaattaga |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27171573 |
ttagcacatcttaatatttaggaaactcactgataaatatacattaatgatagaaaccaaaaagttcacaaaaaaaataaaaatagaaaccagaattaga |
27171672 |
T |
|
| Q |
124 |
gcatggcttaaaagttccatgcaagttgatccatatagtctagatcatgagatataaactcagagttaagtacactctccaacaacccaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27171673 |
tcatggcttaaaagttccatgcaagttgatccatatagtctagatcatgagatataaactcagagttaagtacactctccaacaacccaaa |
27171763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University