View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9788_low_38 (Length: 219)
Name: NF9788_low_38
Description: NF9788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9788_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 1e-24; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 143 - 200
Target Start/End: Complemental strand, 6557680 - 6557623
Alignment:
| Q |
143 |
tgtacacaggcacatcatatgcagcagtttatatctaataacttccttatgtatggca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6557680 |
tgtacacaggcacatcatatgcagcagtttatatctaataacttccttatgtatggca |
6557623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 117
Target Start/End: Complemental strand, 6549003 - 6548945
Alignment:
| Q |
58 |
tagaataagaggtgaaatctccaaatcattattagctttcacaagtgtatcccctaagtt |
117 |
Q |
| |
|
||||||||||| |||||| |||||||||||| |||||| |||||||||||||| |||||| |
|
|
| T |
6549003 |
tagaataagagctgaaatgtccaaatcatta-tagcttgcacaagtgtatcccgtaagtt |
6548945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 55 - 113
Target Start/End: Complemental strand, 6797781 - 6797722
Alignment:
| Q |
55 |
atttagaataagaggtgaaatctccaaatcatt-attagctttcacaagtgtatccccta |
113 |
Q |
| |
|
||||||||| ||| |||||||||||||||||| |||||||| |||||||||||| |||| |
|
|
| T |
6797781 |
atttagaatgtgagatgaaatctccaaatcattaattagcttgcacaagtgtatcaccta |
6797722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 54 - 103
Target Start/End: Complemental strand, 31981825 - 31981775
Alignment:
| Q |
54 |
gatttagaataagaggtgaaatct-ccaaatcattattagctttcacaagt |
103 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
31981825 |
gatttagaataagaggtgaaatgtaccaaatcattattagctttcacaagt |
31981775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 169
Target Start/End: Complemental strand, 31981775 - 31981734
Alignment:
| Q |
128 |
tatcaaaccgttttgtgtacacaggcacatcatatgcagcag |
169 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31981775 |
tatcaaactattttgtgtacacaggcacatcatatgcagcag |
31981734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 42151269 - 42151329
Alignment:
| Q |
57 |
ttagaataagaggtgaaatctccaaatcattattagctttcacaagtgtatcccctaagtt |
117 |
Q |
| |
|
||||||| | || |||||||||||||| ||||||| ||| ||||| |||||| |||||||| |
|
|
| T |
42151269 |
ttagaatgaaagatgaaatctccaaattattattaacttgcacaaatgtatcacctaagtt |
42151329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University