View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9789_high_11 (Length: 249)
Name: NF9789_high_11
Description: NF9789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9789_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 22270070 - 22270149
Alignment:
| Q |
1 |
ctcgccgaaagcgacagcggcggcttggaggcggttgtaagcttcgaagcgagatttggaatcggagtgctttcttgaac |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22270070 |
ctcgccgaaagcgacagcggcggcttggaggcggttgtaagcttcgaagcgagatttggaatcggagtgctttcttgaac |
22270149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 22270252 - 22270316
Alignment:
| Q |
177 |
gggaaaaggaggggagcgatgcaaatgaaatttgaatttgaattttgggttaacgttcctatgct |
241 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22270252 |
gggaaaaggaggggagcgatcaaaatgaaatttgaatttgaattttgggttaacgttcctatgct |
22270316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University