View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9789_high_4 (Length: 344)
Name: NF9789_high_4
Description: NF9789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9789_high_4 |
 |  |
|
| [»] scaffold0040 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 167 - 280
Target Start/End: Original strand, 38372051 - 38372161
Alignment:
| Q |
167 |
cttttgattttgtttttcttgtttcaaagttggttgaagaatggtgctaaatttagtaggattgtttttaataagtttggaagatagtttggtttgctgt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38372051 |
cttttgattttgtttttcttgtttcaaagttggttgaagaatggtgctaaatttagtaggattgtttt---taagtttggaagatagtttggtttgctgt |
38372147 |
T |
 |
| Q |
267 |
atacatgtatcctt |
280 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
38372148 |
atacatgtatcctt |
38372161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 38371885 - 38371981
Alignment:
| Q |
1 |
gggtgcatcatcttcttgttcttctaaatgtgagttgtaaggagcatcattggttgtggaggagacagctcctacggtggaagacattttcaacctt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38371885 |
gggtgcatcatcttcttgttcttctaaatgtgagttgtaaggaacatcgttggttgtggaggagacggctcctacggtggaagacattttcaacctt |
38371981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0040
Description:
Target: scaffold0040; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 280 - 327
Target Start/End: Complemental strand, 60626 - 60579
Alignment:
| Q |
280 |
ttgataaaagttttagaatatagcaatcgatcattagatacaaattat |
327 |
Q |
| |
|
||||||||||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
60626 |
ttgataaaagttttagaatttagccatggatcattagatacaaattat |
60579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 280 - 327
Target Start/End: Complemental strand, 68102 - 68055
Alignment:
| Q |
280 |
ttgataaaagttttagaatatagcaatcgatcattagatacaaattat |
327 |
Q |
| |
|
||||||||||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
68102 |
ttgataaaagttttagaatttagccatggatcattagatacaaattat |
68055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 326
Target Start/End: Original strand, 45265965 - 45266010
Alignment:
| Q |
281 |
tgataaaagttttagaatatagcaatcgatcattagatacaaatta |
326 |
Q |
| |
|
||||||||||||||| || |||| || ||||||||||||||||||| |
|
|
| T |
45265965 |
tgataaaagttttagtatttagccatggatcattagatacaaatta |
45266010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University