View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9789_high_6 (Length: 316)
Name: NF9789_high_6
Description: NF9789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9789_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 5 - 300
Target Start/End: Complemental strand, 39895602 - 39895307
Alignment:
| Q |
5 |
gagaagcaaaggcaaagatcttatgaatagaagaagaattgggtggctttgtgtgtacggaactttgaagcttttgtgaactagcaacttttttggagga |
104 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39895602 |
gagaaccaaaagcaaagatcttatgaatagaagaagaattgggtggctttgtgtgtacggaactttgaagcttttgtgaactagcaacttttttggagga |
39895503 |
T |
 |
| Q |
105 |
agaagatgaagaagaacggtgattatgatggtggcgccgaccttgttttgcagccaatagaagaagcctttcattcaagcataaaggacatacaccaaca |
204 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39895502 |
agaagatgaagaagaacggtggttatgatggtggcgccgaccttgttttgctgccaatagaagaagcctttcattcaagcataaagggcatacaccaaca |
39895403 |
T |
 |
| Q |
205 |
actacttgtttagggtggaaattgcaacatggtttttcatccctatatccattcctattcatgtttgttaataaaggtttttggtacactatgaag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39895402 |
actacttgtttagggtggaaattgcaacatggtttttcatccctatatccattcctattcatgtttgttaataaaggtttttggtacactatgaag |
39895307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University