View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9789_low_14 (Length: 250)
Name: NF9789_low_14
Description: NF9789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9789_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 9 - 241
Target Start/End: Complemental strand, 3531878 - 3531646
Alignment:
| Q |
9 |
agcaaaggtattattcccatttggtaaaatctgtaggtcaattattggctgcagatttgcctcctaagaacaataacaatgttcttatctgatgagtatt |
108 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
3531878 |
agcaaaggtattatccccatttggtaaaatctgtaggtcaattattggctgcagatttgcctcctaagaacactaacaatgttcttatctgataagtatt |
3531779 |
T |
|
| Q |
109 |
ccgccagcgcattttctgcttaggtttatcatccttttgctcatgtgtgaatcatccatttgcaaattgagattcaaccttctgctgaaggcattatgag |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3531778 |
ccgccagcgcatttcttgcttaggtttatcatccttttgctcatgtgtgaatcattcatttgcaaattgagattcaaccttctgctgaaggcattatgag |
3531679 |
T |
|
| Q |
209 |
aaaattaatttagggttggacagtcaatatatt |
241 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
3531678 |
aaaattaatttagggttggaccttcaatatatt |
3531646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University