View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9789_low_22 (Length: 235)

Name: NF9789_low_22
Description: NF9789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9789_low_22
NF9789_low_22
[»] chr3 (2 HSPs)
chr3 (55-196)||(34648379-34648520)
chr3 (16-196)||(52838376-52838551)
[»] chr8 (3 HSPs)
chr8 (14-196)||(6248051-6248233)
chr8 (14-109)||(26092199-26092293)
chr8 (14-109)||(9487361-9487456)
[»] chr6 (1 HSPs)
chr6 (58-197)||(12884420-12884558)
[»] chr4 (1 HSPs)
chr4 (15-109)||(1323677-1323771)
[»] chr7 (1 HSPs)
chr7 (141-193)||(27936485-27936537)


Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 55 - 196
Target Start/End: Complemental strand, 34648520 - 34648379
Alignment:
55 attttggtcccttgattttttcaatttcttaaattgaatccaaaatttaaattgatgttggtgttgcgcaattttagattatatgacactcaacttagta 154  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
34648520 attttggtcccttgattttttcaatttcttaaattgaatccaacatttaaattgatgttgatgttgcgcaattttagattatatgacactcaacttagta 34648421  T
155 cacacatgaatgccacgtcagattaaacttaaaataatatta 196  Q
    ||||||||||||| ||||||||||||||||||||||||||||    
34648420 cacacatgaatgctacgtcagattaaacttaaaataatatta 34648379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 16 - 196
Target Start/End: Original strand, 52838376 - 52838551
Alignment:
16 caatttctagattttggtcccctgatttttaaatccaaaattttggtcccttgattttttcaatttcttaaattgaatccaaaatttaaattgatgttgg 115  Q
    ||||||||  |||||| ||| || |||||||||| ||  ||||||||||||| ||||||||||||| ||||||||||||||  |||| |||||||||||     
52838376 caatttctgaattttgatccactaatttttaaattcacgattttggtcccttaattttttcaattttttaaattgaatccatcatttcaattgatgttga 52838475  T
116 tgttgcgcaattttagattatatgacactcaacttagtacacacatgaatgccacgtcagattaaacttaaaataatatta 196  Q
    ||| ||| ||||||| || || || |||| |||||| |||||||    |||||| |||| ||||||||| |||||||||||    
52838476 tgtggcgtaattttatatgatgtgccactaaacttaatacacac----atgccatgtcatattaaactt-aaataatatta 52838551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 6248233 - 6248051
Alignment:
14 atcaatttctagattttggtcccctgatttttaaatccaaaattttggtcccttgattttttcaatttcttaaattgaatccaaaatttaaattgatgtt 113  Q
    ||||||||||  | ||||||||  |||||| |||||||| ||||||| |||||||||||||  ||| | | ||||||||||||| |||| |||| |||||    
6248233 atcaatttctgaaatttggtcctttgatttctaaatccacaattttg-tcccttgatttttcaaatatttgaaattgaatccaacatttcaattaatgtt 6248135  T
114 ggtgttgcgcaattttagattatatgacactcaacttagtacacacatgaatgccacgtcagatt-aaacttaaaataatatta 196  Q
    | |||  | ||||||||||| || || |||| ||||||||||||||||| |||||| ||| |||| |||||||| |||||||||    
6248134 gatgtgacacaattttagatgatgtggcactgaacttagtacacacatggatgccatgtcggattaaaacttaatataatatta 6248051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 14 - 109
Target Start/End: Original strand, 26092199 - 26092293
Alignment:
14 atcaatttctagattttggtcccctgatttttaaatccaaaattttggtcccttgattttttcaatttcttaaattgaatccaaaatttaaattga 109  Q
    |||||||||| |||||||||||||  |||| |||||||| ||||| ||| | |||||||||||||||| | ||||||||| ||| |||| ||||||    
26092199 atcaatttctggattttggtcccccaatttctaaatccataatttcggt-cattgattttttcaatttttaaaattgaattcaacatttcaattga 26092293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 109
Target Start/End: Complemental strand, 9487456 - 9487361
Alignment:
14 atcaatttctagattttggtcccctgatttttaaatccaaaattttggtcccttgattttttcaatttcttaaattgaatccaaaatttaaattga 109  Q
    |||||||| | |||||| |||| |  |||||||||| ||  ||||||||||||||||||||  ||||| | ||||||||||||| |||| ||||||    
9487456 atcaatttttggattttagtcctccaatttttaaattcacgattttggtcccttgatttttctaatttttaaaattgaatccaacatttcaattga 9487361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 58 - 197
Target Start/End: Complemental strand, 12884558 - 12884420
Alignment:
58 ttggtcccttgattttttcaatttcttaaattgaatccaaaatttaaattgatgttggtgttgcgcaattttagattatatgacactcaacttagtacac 157  Q
    ||||||||||||||||| ||||||||||||| ||||||||  ||| ||||||||||| ||| ||  ||||||| || ||||| |||| || |||||| ||    
12884558 ttggtcccttgatttttccaatttcttaaatagaatccaacgtttcaattgatgttgatgtggcaaaattttacatgatatggcacttaa-ttagtatac 12884460  T
158 acatgaatgccacgtcagattaaacttaaaataatattac 197  Q
    ||||| || ||| |||| ||||||||||||||||||||||    
12884459 acatggataccatgtcacattaaacttaaaataatattac 12884420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 109
Target Start/End: Complemental strand, 1323771 - 1323677
Alignment:
15 tcaatttctagattttggtcccctgatttttaaatccaaaattttggtcccttgattttttcaatttcttaaattgaatccaaaatttaaattga 109  Q
    ||||||| | |||||||||||||   |||||||||||  |||||||||||||  | ||||| ||||| ||||||||||||||| |||| ||||||    
1323771 tcaatttttggattttggtccccccttttttaaatccgcaattttggtccctcaagttttttaattttttaaattgaatccaagatttcaattga 1323677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 141 - 193
Target Start/End: Complemental strand, 27936537 - 27936485
Alignment:
141 cactcaacttagtacacacatgaatgccacgtcagattaaacttaaaataata 193  Q
    |||| ||||| ||||||||||  |||||| |||| ||||||||||||||||||    
27936537 cactaaactttgtacacacattgatgccatgtcatattaaacttaaaataata 27936485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University